Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST43285
Clone ID OST43285
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST43285
Sequence
GAACTGAGGATATCACCATTGGGCTCACTTCCTGCTTCGTGTGTTGTCTTCTGCCTGCGGGCTGGGTCCTGTCACACCTG
GAGAGCTACAAGAAGCGGGAGTGAAGGGAGCAGTCTTCCCTCATCCTTTGACTAGACCACTTTTGCCAGCCCACCTTGAT
CATGTTGCCTGCATTCCTGGCTGGCCTTCCCCGGGATCATGTTATTCAATTCCAGTCACCTCTTCTGCAATCATGACCTC
TCGATGTCTCCATGGTGACAACTGGGACCACATGTATTGGCTCTGCTTGGAGGGGTCCCCCTTTGTAACAATAAAGTCTA
TTTAAACCTTGCAA
Sequence Type mRNA
Unitrap ID UNI10860

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7289651..7289976 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035885 (Cox8a) NM_007750 cytochrome c oxidase, subunit VIIIa Gene [Source:MGI Symbol;Acc:MGI:105959]

 
Come back to gene ENSMUSG00000035885


For any suggestions or comments, please send an email to unitrap@crg.es