Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XF586
Clone ID XF586
Vector pGT2Lxf
Project baygenomics

Sequence tag XF586
Sequence
CAGTCGTGTGGGTAGCAGGCCCCAAGTGACAGCAGCATGGAGGAATTCGACTCCGAAGACTTCTCCACATCGGACGAGGA
TGAGGACTACTTGCCGTCCGGTGGAGAGTACAGTGAAGATGATGTCAATGAATTAGTAAAGGAAGATGAAGTGGACGGTG
AAGAGCAGGCTGAGAAAACCAAAGGGAAAAGAAGGAAGGCTCAGGGCATTCCAGCCAGGAAAAGGAAACAAAGTGGCCTC
TTGTTAGAAGAAGAGGAAGATGGCAAGGAAGACTCTGGAGGTAGTAGCAGTGAAGAAGATGAAGAGGAGCAAGAAGGAGG
CCTTGGGTCAGAGAATGCAAGGAAGAAGAAGGAAGATGAGTTGTGGGCCAGCTTCCTTAATGATGTAGGACCAAAGTCAA
AAGCAGCCCCAGGTTCACAAACTAAGGTAGCCGAGGAGACTGAAGAGATTAGTTCGAATAAACCGTTGGTCAAAGCAGAT
GAGCTGGATAAGCCTAGAGAATCAGAAAAGGTGAAGATTACCAAGGTGTTTGACTTCGCTGGCGAAGAAGTAAGGGTGAC
TAAGGAAGTAGATGCTGCGTCTAAGGAAGCGAAGTCTTTCCTCAAGCAAACAGAGAGAGAAAAACCGCAGGCTCTTGTCA
CTTCACCAGCGACACCACTCCCTGCTGGGTCAG
Sequence Type mRNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114354771..114378143 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es