Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42939
Clone ID OST42939
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42939
Sequence
TGAGACAGGCTACTTGGTACTTATTGCGGTTATGCTGGTATCTCGAACATACTGTGATGTTTGGATGATTCAGAATGGGA
CGCTCATTGAGAGTGGCATCATTGGTCGCAGCAGCAAAGATTTCAAGAGATACTTATTCAACTTCATCGCTGCCATGCCT
CTTATCTCTCTGGTTAATAACTTCTTGAAGTATGGGTTAAATGAGCTCAAACTGTGCTTCCGAGTCAGGCTCACACGGTA
CCTCTACGAGGAGTATCTCCAAGCTTTCACCTATTATAAAATGGGCAACCTGGATAACAGAATAGCAAATCCAGACCAGC
TGCTTACACAGGATGTAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27987

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121486971..121494742 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028127 (Abcd3) NM_008991 ATP-binding cassette, sub-family D (ALD), member 3 Gene [Source:MGI Symbol;Acc:MGI:1349216]

 
Come back to gene ENSMUSG00000028127


For any suggestions or comments, please send an email to unitrap@crg.es