Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42929
Clone ID OST42929
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42929
Sequence
ACTGAGGTGAAGGACTTAACTCAGTACCTGGACCCGAGTGGGCTTGGCGTAATCAGCTTTGAAGATTTCTACCAAGGGAT
TGTAGCCATCAGAAATGGAGGTA
Sequence Type mRNA
Unitrap ID UNI27988

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26173531..26173629 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037098 (Rab11fip3) RAB11 family interacting protein 3 (class II) Gene [Source:MGI (curated);Acc:Rab11fip3-001]

 
Come back to gene ENSMUSG00000037098


For any suggestions or comments, please send an email to unitrap@crg.es