Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42783
Clone ID OST42783
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42783
Sequence
ACTGGGCTTGATTTAAATTTGGATGAGATTATTCTTGCATCAAGATGTTAATAAGCCAAAATTTAGACTAAAGGTGTTAA
ATGATCTTGCCAACAATATGGATGATTTGAAGATAAACACCGACATTACTGGTGCTAAAGAAGAACTCCAAGATGACAAC
AATTTTATCTCTGAGAAAGACAGTGGAGTTCATAAACCAAAAGATTGTCAGACATCATTTCAGAAAAACAGTTCATTGAC
TCGATCTGAGGAATTGTCAGAGGATCAATCAGAACAAGCCTTAAGTGGAGGCCAGTCTGCTTTGTTTCTCCCTGCCAGCA
CTCCTGCTGTTCCTACTGAAAACTTTCCCTTGCCCACAGGAGCTGTTGTTAATGGACCAGTCTCATGCTCCTCCTCCACA
AAGACTTCCAATATGAATGAAGGTAGTGTTTCATTAACCCCTGGACAGCCTGCAGATCAGCTAGCAGCAGAAGTCTTGCT
CCACTTTGAAAGC
Sequence Type mRNA
Unitrap ID UNI9369

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 107067229..107095865 425
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049606 (Zfp644) NM_026856 zinc finger protein 644 Gene [Source:MGI (curated);Acc:Zfp644-001]

 
Come back to gene ENSMUSG00000049606


For any suggestions or comments, please send an email to unitrap@crg.es