Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42760
Clone ID OST42760
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42760
Sequence
ACTGAGCTATAACCCGTGGTGGAAGTAGCCAGTGAGTACCCTGCACCATGGCACTGCCGTTCCGGAAGGACTTGGGGGAC
TACAAGGACCTGGATGAGGACGAGCTCCTTGGCAAGCTGTCCGAATCAGAGCTGAAACAGCTGGAGACTGTCCTGGATGA
TCTTGACCCCGAGGNCGGTGCTAACCGAAGAAGAGATAGCGACCGTNTGGCTCAGTAGCTGCCGTCTAACCANCTTGCTT
TCTCGTGCCTTTTCCCATACCCTTTACCCACTTTCTGTCCAGATGAACTGGNTTTTTGCTTCTTNTCCAGGTCCCCATAT
CTACCTNCACATCTTATGACACAGGCATTTTAAACCATCATTAAACATCTACACAATTNCTTTTCTCCAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75380017..75380401 371
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058587 (Tmod3) NM_016963 tropomodulin 3 Gene [Source:MGI Symbol;Acc:MGI:1355315]

 
Come back to gene ENSMUSG00000058587


For any suggestions or comments, please send an email to unitrap@crg.es