Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42746
Clone ID OST42746
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42746
Sequence
AGACTGAGGTTGTTGCAATCCTGTGCTCCAGAAGTGGTGGCTTTGAGGTGTGACCCTGCCCACATTTGGGCCCAGTCCTC
ACCAGCTCCTCGGCAGAACGAAGAAAACAGCATAAAGGAGTGATATCCAGAGAATAAAAGGGCTCCCCAGAGTCATTTCC
TACTCCATGTGGATGACAGCAGGAGCAAGGGACTATCATTTGGGGCAGAAAATGGAGTTCTATAGCAGAGACTTCTTAGA
AGCATAAAACCCTGTCCCGATGACGTCGAATTCGCCCATTGGTTTAGAAGGCTCAGACCTGTCTTTCATCAACACCATGA
TGTCAGCAGTAATGACCGTAGCGAGGTGTCACAANAGAATGGTGGGAGCCCCCAGGGCATCAAGTCCCCCATGAAANCTT
CCAGGACCAAATCGGATTGGCAGAAGGAACCAGGAAACGAAAGAGGAGAAA
Sequence Type mRNA
Unitrap ID UNI14264

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37980738..37990297 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039087 (Rreb1) NM_001013392 ras responsive element binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443664]

 
Come back to gene ENSMUSG00000039087


For any suggestions or comments, please send an email to unitrap@crg.es