Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42723
Clone ID OST42723
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42723
Sequence
GACTGAGATCAATAACTCGATCCTATTACCGCAACTCAGTTGGAGGATTTTTAGTGTTTGACATTACTAACCCGACGGTC
TTTTGAACATGTGAAAGATTGGCTAGAAGAAGCAAAAATGCATGTACAGCCTTTTCAGATTGTATTTCTACTGGTGGGAC
ATAAATGTGACCTGGCTTCGCAACGCCAGGTTTCAAGGGAAGAAGCTGAAAGACTGTCAACAGACTGTGGAATGAAGTAC
ATAGAGACCTCAGCCAAGGACGCGACAAACGTTGAAGAGTCCTTTACAATCCTGACTTTTCCTATAC
Sequence Type mRNA
Unitrap ID UNI27998

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53494554..53494843 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055069 (Rab39) NM_175562 RAB39, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab39-001]

 
Come back to gene ENSMUSG00000055069


For any suggestions or comments, please send an email to unitrap@crg.es