Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42702
Clone ID OST42702
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42702
Sequence
CTGAGTTACATATCATTGAAGTTGGTGCCCCACCCACAGGGAATCAACCCTTCCCAAAGAAGGCAGTGGATGTTTTCTTT
CCTCCAGAAGCACAAAATGACTTTCCTGTTGCAATGCAGATCAGTGAAAAGCATGATGTGGTGTTCTTGATTACCAAGTA
TGGTTATATTCACCTCTATGATCTTGAGACTGGCACGTGCATCTACATGAACAGAATCAGCGGAGAAACCATCTTCGTCA
CTGCACCTCATGAAGCCACAGCTGGAATAATAGGAGTCAACAGAAAGGGACAGGTAAGGAAACCTTGAAACTTCAGCATT
TAAGTAGCACATTATCATTAGCACTTTTTTTTGGTTTTTTTTTTTTT
Sequence Type mRNA
Unitrap ID UNI28000

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86543640..86544335 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047126 (Cltc) NM_001003908 clathrin, heavy polypeptide (Hc) Gene [Source:MGI (curated);Acc:Cltc-001]

 
Come back to gene ENSMUSG00000047126


For any suggestions or comments, please send an email to unitrap@crg.es