Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XF421
Clone ID XF421
Vector pGT2Lxf
Project baygenomics

Sequence tag XF421
Sequence
CCCAGTTTCCCCCGCGGTTCGTGCACTGAGGTTGTCGCCGGCGCGTCCCCTATCCCGCGGCTCGCTCGCCCTGCCGGTGC
CATGGCGGCCTTCAGCAAGTACTTGACGGCACGGAACACCTCGCTGGCGGGGGCCGCGTTCCTGCTGCTCTGCCTACTCC
ATAAGCGGCGTCGCGCCCTCGGCCTGCACGGTAAGAAAAGTGGAAAACCGCCATTACAGAATAATGAGAAAGAAGGAAAG
AAAGAGCGAGCTGTGGTGGACAAAGTGTTTTTATCAAGGCTCTCACAGATCCTAAAAATTATGGTTCCTAGAACATTTTG
TAAAGAGACAGGCTACTTGTTACTTATTGCGGTTATGCTGGTATCTCGAACATACTGTGATGTTTGGATGATTCAGAATG
GGACGCTCATTGAG
Sequence Type mRNA
Unitrap ID UNI9023

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121494654..121518117 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028127 (Abcd3) NM_008991 ATP-binding cassette, sub-family D (ALD), member 3 Gene [Source:MGI Symbol;Acc:MGI:1349216]

 
Come back to gene ENSMUSG00000028127


For any suggestions or comments, please send an email to unitrap@crg.es