Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42553
Clone ID OST42553
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42553
Sequence
GACTGAGGTTTCCTTACAAATTTGAAGTACAACAGATGTTAGAAGAACCTCAGTGGGAATTAGTGTTTGAAAAGACAAGA
TGGATAATCGAAAAATACAGGCTTTCTAATAGCAGCGTCCCCATGGATAGAATCTTTCGCCGGGATTCCGACCTAACTTG
TCTGCAGAAACTTTTGGAGTGTCTAAGGAAAACACTGAGCAAAGTAGCCAATTGCTTCATCGCTGAGGAGTTCTTGACTC
AAATAGAAAATCTGTTCCTTTCCAATTACAAAAGCAAGGAAGAGAATGGACTGGCAGAAGAGGATAGTACAAAGGAATTG
TTCATGTAATTATTTTAAAGTAAGATGTTCTAATCTTGGCATGCTACTGTAAATAATTGAGATTTTAAAGCAATATAAAA
AAAA
Sequence Type mRNA
Unitrap ID UNI28004

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 94613586..94615130 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062627 (Mysm1) NM_177239 myb-like, SWIRM and MPN domains 1 Gene [Source:MGI (curated);Acc:Mysm1-001]

 
Come back to gene ENSMUSG00000062627


For any suggestions or comments, please send an email to unitrap@crg.es