Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42543
Clone ID OST42543
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42543
Sequence
AGCGCATTGTGCAGGATGTATCCTTCTTTCCTTCCGGGGCTCACGGAACANTGCCGATGTCTGCACCTCGTGAAGGCCAG
AGAGGGAGGGACTACTTCTTGATTCCCAGACTCTTTCTGCTGAGAGAGAACATGAATTAAAGGTTTAA
Sequence Type mRNA
Unitrap ID UNI3664

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87562372..87562518 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031691 (Tnpo2) NM_145390 transportin 2 (importin 3, karyopherin beta 2b) Gene [Source:MGI Symbol;Acc:MGI:2384849]

 
Come back to gene ENSMUSG00000031691


For any suggestions or comments, please send an email to unitrap@crg.es