Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XF504
Clone ID XF504
Vector pGT2Lxf
Project baygenomics

Sequence tag XF504
Sequence
GGGCCTTTCTGTAACTCAGCAGTCATGAGAGTTTCTGTGTGATGTGTTCTGCGTGACTCTACTGGGTGTTGTGAGAGGAG
GTTAGTCAAGCTCAGAACTCCAAACATGGATTTACTCACCTATGATGACGTGCATGTGAACTTCACTCAGGAAGAGTGGG
CTTTGCTGGATGCTTCTCAGAAGAGTCTCTACAAAGGTGTGATGGTAGAGACCTATAGGAATCTCACAGCTATAGGTTAC
AGTTGGGAAGAACATACAATTGAAGACCATTTCCAAACTTCTAGAAGTCATGGA
Sequence Type mRNA
Unitrap ID UNI8997

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175791860..175800195 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078889 (OTTMUSG00000016618) NP_001028295 predicted gene, OTTMUSG00000016199 Gene [Source:MGI Symbol;Acc:MGI:3706570]

 
Come back to gene ENSMUSG00000078889


For any suggestions or comments, please send an email to unitrap@crg.es