Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42218
Clone ID OST42218
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42218
Sequence
AGACAACCCCCACTTTGAAAATGGGGAGACAGTCAATCGNCATCTCAGATGTGCTCCCAGGTGGACCCGCTGATGGCTTG
CTTCAAGAAAATGACAGGGTGGTCATGGTCAATGGCACCCCCATGGAAGATGTGCTCCATTCGTTTGCCGTTCAGCAGCT
TAGGAAAAGTGGGAAGATAGCAGCCATCGTAAGTCCTGGCTGGGATGGCACTCGGTGTGGTCGGTACATGCTTGTAAGCC
AACATCCTTACGCGTAAACCGNAAATAAATTNAAAAACCNAATTTTTTCAAAAAAAAT
Sequence Type mRNA
Unitrap ID UNI15883

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 24206998..24209423 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024812 (Tjp2) NM_011597 tight junction protein 2 Gene [Source:MGI Symbol;Acc:MGI:1341872]

 
Come back to gene ENSMUSG00000024812


For any suggestions or comments, please send an email to unitrap@crg.es