Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42188
Clone ID OST42188
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42188
Sequence
GAGATGAGTGTGGGGCGTCGAAGAGTCAAGTTGCTGGGCATCCTGATGATGGCAAATGTCTTCATTTATTTGATTGTGGA
AGTCTCCAAAAACAGTAGCCAAGACAAAAATGGAAAGGGAGGAGTAATAATCCCGAAAGAGAAGTTCTGGAAGCCACCCA
GCACTNCCCGGGCATACTGGAACAGGGAACAGGAGAAGCTGAACAGGTGGTACAATCCCATCTTGAACAGGGTGGCCAAT
CAGACAGGGGAGCTAGCCACATNTCCAAACACAAGTCACCTGAGCTATTGTGAACCAGACTCGACGGTCATGACAGNTGT
GACAGATTTTAATAATCTGCCGGACAGATTTAAAGACTTTCTCTTGNATTTGAGATGCCCGGAATTACTCGCTTGCTTAT
AGATCAACCGAAGAAATGTGCAAT
Sequence Type mRNA
Unitrap ID UNI10281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22736769..22737189 407
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051650 (B3gnt2) NM_016888 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI (curated);Acc:B3gnt2-002]

 
Come back to gene ENSMUSG00000051650


For any suggestions or comments, please send an email to unitrap@crg.es