Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42177
Clone ID OST42177
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42177
Sequence
GACTGAGGATTTGGAGTTTCATGGAGTCATGAGATTTTATTTTCAAGATAAAGCTGCTGGAAACTTTGCAACAAAATGTA
TTCGAGTCTCTAGCACAGCCACCACTCAAGATGTGATTGAAACACTGGCAGAGAAGTTCCGCCCTGACATGCGCATGCTC
TCCTCTCCCAAGTACTCCCTCTATGAAGTGCATGTCAGTGGAGAAAGAAGATTGGACATTGATGAGAAACCTCTAGTTGT
ACAGTTGAATTGGAACAAAGATGATCGAGAGGGTCGATTCGTCCTTAAGAACGAGAATGACGCCATTCCTGCCAAGAAGG
CTCAGAGTAATGGACCTGAAAAGCAGGAGAAAGAANGTGTTATTCAGAACTTCAAAAGAACTCTCTCAAAGAAAGAAAA
Sequence Type mRNA
Unitrap ID UNI23928

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13940944..13946021 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068036 (Mllt4) NP_034936 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene [Source:MGI Symbol;Acc:MGI:1314653]

 
Come back to gene ENSMUSG00000068036


For any suggestions or comments, please send an email to unitrap@crg.es