Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42153
Clone ID OST42153
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42153
Sequence
TCAGCCCTGGGGAGTCCCTGTGGAAGTGGAGTCTCTCCTGGTCCACCCTGGCGACCTGCTACAGCTTCGCTGTCGGCTTC
GCGATGATGTGCAGAGCATCAACTGGCTGCGGGATGGGGTGCAGCTGGTGGAGAGCAACCGTACCCGCATCACAGGGGAG
GAGGTGGAGGTGCGGGACTCCATCCCCGCTGACTCTGGCCTCTACGCTTGCGTGACCAGCAGCCCCTCTGGCAGCGATAC
CACCTACTTCTCCGTCAATGTCTCAGATGCACTCCCATCCTCGGAAGATGATGACGACGACGATGACTCCTCCTCGGAGG
AGAAAGAGACGGACAACACCAAACCAAACCGTAGCCTGTAGCTCCTACTGGACATNCCCAGAGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26665981..26668575 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es