Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42142
Clone ID OST42142
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42142
Sequence
AACTGAGTACTCTCCCAGCATGAGACCCACCTACATGTCCGTGGCGGATGAACACCTGAGACACTACGAGTTCCCGTCCT
AGGGGCTTTCAGTGTACCTGCCTCTTCTGCCAGCTCGGTTCTCAGCAGATGCAGAACCCAGCTGTGTTTCTGGAATAGAA
ACCGAAGGTTCCTGGACACGAACAGGCTCCTGTGGCTGCAGAGACACAGCTGGGACTCCTGACCAAAGCCACAGGTGGAC
GTGAGGCCTGTGACTGGACCAGCCTCTCCGGCCTTAACTCCCCCAGGACTCAGCTGTTGTCCCTGAGGCAGCTGCCCGCT
TCAGCCCACCTTAAGTCCCACCCTCAGCAGATGAAAAATGGTAATTGAGGAGGGGACCACCACCTGAGAGCCCTTTTCTC
TAAAGGCCCTTCCATTGGGCTCCTGCCTCTTC
Sequence Type mRNA
Unitrap ID UNI28026

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 114580441..114580867 423
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034714 (Ttyh2) NM_053273 tweety homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Ttyh2-001]

 
Come back to gene ENSMUSG00000034714


For any suggestions or comments, please send an email to unitrap@crg.es