Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST596
Clone ID RST596
Vector pGT1TMpfs
Project baygenomics

Sequence tag RST596
Sequence
GGGCTCCTTTCCGCAGGGCCAGCTTTCAATATTGCAAGAAAAGATTGACCATTTGGAGCGTTTGCTCGCTGAGAACAACG
AGATCATCTCAAATATCAGAGACTCAGTCATCAACCTGAGCGAGTCTGTGGAGGACGGCCCGCGGGGGTCACCAGGCAAC
GCCAGCCAAGGCTCCATCCACCTCCACTCGCCACAGTTGGCCCTGCAGGCTGACCCCAGAGACTGTTTGTTTGCTTCACA
GAGTGGGAGTCAGCCCCGGGATGTGCAGATGTTGGATGTTTACGATCTGATTCCTTTTGATAATCCAGATGGTGGAGTTT
GGAAGCAAGGATTTGACATTAAGTAT
Sequence Type mRNA
Unitrap ID UNI9028

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 64951195..64974724 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024085 (Man2a1) NM_008549 mannosidase 2, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:104669]

 
Come back to gene ENSMUSG00000024085


For any suggestions or comments, please send an email to unitrap@crg.es