Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST42067
Clone ID OST42067
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST42067
Sequence
CCTGGTGGTGAGAGAGAGGATGGGACTCCTGGACCCATCCCAGAAAGAGGTGCTGAGATTCGCAGTAAACTGCCGCATCC
TGACTCTAGTGCTACAGGTTCTNACGCGGNTTTTGGCCTCTTNCACTCCTATCATGTACTGGTTTCCAGCTCACCTGCTT
CAGGATCAANAACCGNTGCTGAGGTGTGTGGACACAGAGCCTGGGAAGCTTCCTCAGGAGAAGCCCCCACCAGGACAGAA
GGCCCCCAGAAACTGCCTCATGAAACTCTTCTACGATTGGAANAGCTGCTCGCCAGTNACAANATGCGTTCTGGTCTACT
TCCTGACCTACTGGCTTCTGGGACTAATTCTCCATTGCAACTTCCTGCCTTGGACTTGACCTGGAGTGTCAAGGGTTGAA
AGCTCTNAGACGACACCCTGGCTGGGACAGCCCGCACACTCCGGAGAGCACTGTGCAGTAGGATCTCTGGGTCTCTCTGG
GGGCCAGCTTAANAAGGGAAAATGGGAGCCCAGGCGCCCCTTNTCATCCTGGGCGGGGCAGGTGTAGGGGAGTACTTCAG
NGCTCANGCANGGGTCTAAATNTCCTAGTCCCAAGTCTAGCAATCTAACTATACTGTC
Sequence Type mRNA
Unitrap ID UNI8531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133218192..133225749 440
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043257 (Pigv) NM_178698 phosphatidylinositol glycan anchor biosynthesis, class V Gene [Source:MGI (curated);Acc:Pigv-002]

 
Come back to gene ENSMUSG00000043257


For any suggestions or comments, please send an email to unitrap@crg.es