Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XK272
Clone ID XK272
Vector pGT0Lxf
Project baygenomics

Sequence tag XK272
Sequence
GGTAACTCAGCAGTCATGAGAGTTTCTGTGTGATGTGTTATGCGTGACTCTACTGGGTGTTGTGAGAGGAGGTTAGTCAA
GCTCAGAACTCCAAACAT
Sequence Type mRNA
Unitrap ID UNI4716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175605173..175605269 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078891 (BX890623.7-201) Novel KRAB box and zinc finger, C2H2 type domain containing protein [Source:UniProtKB/TrEMBL;Acc:B1AYE1]

 
Come back to gene ENSMUSG00000078891


For any suggestions or comments, please send an email to unitrap@crg.es