Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST41304
Clone ID OST41304
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST41304
Sequence
AGAACACCACTGATGACATGGCCAGGAACAGGAATGGAGCCGACTCTTCTGTCCTGAGTGTTCCCAGANAGCAGAGTGNT
GAGGACCNGTCTGCTGANATCTTCAACTATGAAGAATACTGTGTCCCGAAGGCCGTCACTGGGCCGTGCCGCGCAGCCTT
CCCTCGCTGGTACTATGACACTGAAAAGAATTCCTGTATCAGCTTCATCTACGGCGGGTGCAGAGGCAACAAGAACAGTT
ACCTCTCCCAGGAAGCATGCATGCAGCACTGCTCTGGTAAGCAGATGCATCCTTTCCTGACCCCGGGCCTAAAAGCGGTG
AACCTGGTGGGGCTTGTCCCTCATGGGTTCTGATCCTCCTTCCTGGGGAACCT
Sequence Type mRNA
Unitrap ID UNI13232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30041803..30045449 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074227 (Spint2) NM_001082548 serine protease inhibitor, Kunitz type 2 Gene [Source:MGI Symbol;Acc:MGI:1338031]

 
Come back to gene ENSMUSG00000074227


For any suggestions or comments, please send an email to unitrap@crg.es