Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST41276
Clone ID OST41276
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST41276
Sequence
GCAGCCTGCTTCTGCAAAGTGGTACGATCGAAGGGACTATGTATTCATTGAATTTTGTGTTGAAGACAGTAAAGATGTTA
ATGTAAACTTTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI2259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127505728..127505824 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 85793976..85794072 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040078 (AC161888.5)  

 
Come back to gene ENSMUSG00000040078


For any suggestions or comments, please send an email to unitrap@crg.es