Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XK388
Clone ID XK388
Vector pGT0Lxf
Project baygenomics

Sequence tag XK388
Sequence
ATTTTTCCGGGGGGGGCAAAAAGGGGGGGGGGGGTTTTTAAAAAGGGTTTTTTTTTTTTTGTGGACCCCGCGCCGACGGC
TGCTCAAACATCAGGCTGGCCCCACAAAGGACATTATCAAAGTCCCCAGCCTGGGGCCCTGTGTAGACCTGGAGTGGCCA
CCGCACCCTTCCCTTCATGATTCGTTCATAGCACAGTGGAAATGGATGATGAGGATGGGAGATGCTTACTAGACGTGATT
TGTGATCCTCAGGCCCTCAATGATTTCTTGCATGGATCCGAGA
Sequence Type mRNA
Unitrap ID UNI9047

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16581752..16633276 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070808 (Gltscr1) NM_001081418 glioma tumor suppressor candidate region gene 1 Gene [Source:MGI Symbol;Acc:MGI:2154263]

 
Come back to gene ENSMUSG00000070808


For any suggestions or comments, please send an email to unitrap@crg.es