Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST41018
Clone ID OST41018
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST41018
Sequence
AGCTAAGCTGGCTTCTCTTTTTGGACTGGATCAAGCAACTATGGGCCATGGAAATGAATTCTTCCAGTACACAGCCCCAA
AGCAACCTAAGAAAGGCCAGGGAACAGCAGCAGGAAATCAGACAGCACCAAAGCCAGCCCCAGCTACCACAGGCACGTCC
TCAGTGCTGTTTGCCACTGCAGTGCATGCATACCGCTACATAAATGGTCAATATGCAAAGCAGGGCAAATTTGGAGCGGC
TGTCCTGGGGAACCACACAAGCAGAGAGGTGAGAAGACCCACATTGATTTATACGCCACATCCCAAGAATTGTTAATGCC
TCGGGTCTGGTTCTTATCTGTTGGATAGAGACTTATGTGTTAGATGATAAGAATGTCTAC
Sequence Type mRNA
Unitrap ID UNI28066

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 62006430..62013579 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066151 (Fkbp15) FK506 binding protein 15 Gene [Source:MGI (curated);Acc:Fkbp15-003]

 
Come back to gene ENSMUSG00000066151


For any suggestions or comments, please send an email to unitrap@crg.es