Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AZ0883
Clone ID AZ0883
Vector pGT0lxr
Project sanger

Sequence tag AZ0883
Sequence
ATTTCCTCGGGGGGAAAAAAAACCTTTCCCCCGGGTATGGAAGTGGACTTTTTTTTTTTTTTTCATTTCCCTCATCTTCC
TACTCCTTACTTTCTAACTTATTGATTTCCTAGAGCAGCAGATGCACCCAACAGTGGTGATCAGTGCTTACCGCATGGCA
CTGGATGATATGATCAGCACTCTGAAGAAAATCAG
Sequence Type mRNA
Unitrap ID UNI972

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88108964..88109052 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001416 (Cct3) NM_009836 chaperonin containing Tcp1, subunit 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:104708]

 
Come back to gene ENSMUSG00000001416


For any suggestions or comments, please send an email to unitrap@crg.es