Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XK134
Clone ID XK134
Vector pGT0Lxf
Project baygenomics

Sequence tag XK134
Sequence
TTAATGCACTTCTACCGCTGGCTCCAGTCACCGTGCTCTCTGCTCCACGACCCAGCCCTTCACCGGACGCTGCACAATAT
GATGAAGAAGCTCTTCCTGCAGCTCATTGCTGAGTTCAAGCGCCTGGGGTCATCAGTCGTCTATGCCAACTTCAATCGCA
TCATTCTCTGTACAAAGAAGCGCCGAATAGAGGATGCCCTTGCCTATGTGGAATATATTACCAACAGCATCCATTCTAAA
GAGATCTTCCATTCCCTGACCATCTCTTTCTCTCGATGCTGGGAATTCCTTCTCTGGATGGATCCATCCACACTATGGTG
GAATCAAAGGAAAAGTTCCATCTAGTATTCACTGTGGACAGGTAAAAG
Sequence Type mRNA
Unitrap ID UNI9059

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110756795..110760087 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007080 (Pole) NM_011132 polymerase (DNA directed), epsilon Gene [Source:MGI (curated);Acc:Pole-001]

 
Come back to gene ENSMUSG00000007080


For any suggestions or comments, please send an email to unitrap@crg.es