Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST40455
Clone ID OST40455
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST40455
Sequence
AGCTGATTTATCCAGAGCCCAGCATGGGTTTCCTGACTGCCGTGACTCAAGGCCTGGTGCGGGGAGCTGACAGGATGAGC
AAGTGGACAAGCAAGCGGGGACCACGCACCTTCACTAAGAGTCGGGGTGCCAAGAAAACAGGCATCTATACTTCTGATAG
GAAGTTTGTGCAAATAAAAGAAATGGTTCCAGAATTTGTCGTCCCGGACTTGACGGGCTTCAAGCTCAAGCCCTACGTTA
ATTACCGAGCTCCTGCAGGCATAGACACACCTCTGACCGCCAAAGCGCTCTTCCAGGAAACAGTTGCACCCGCTATCGAA
AAAGACTTTAAAGAAGGGACATTTGATGCTAACAACCTGGAGAAATCCGGTTTNAANCCACACAGGAAGGCAAGCTGGTC
CAATATATCCT
Sequence Type mRNA
Unitrap ID UNI13909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 24829789..24830201 393
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036850 (Mrpl41) NM_001031808 mitochondrial ribosomal protein L41 Gene [Source:MGI (curated);Acc:Mrpl41-001]

 
Come back to gene ENSMUSG00000036850


For any suggestions or comments, please send an email to unitrap@crg.es