Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST40426
Clone ID OST40426
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST40426
Sequence
GATGAACTGACCCATGATGATGTGCATGTGAACTTCACTCAAGAAGAATGGGCTTTGCTGAATCCTTCACAGAAGAGCCT
CTACAGAGATGTGATGTTGGAGACCTATAGGAACCTCAATGCTGTAGGCTACAATTGGGAAGACCGTGATATTGAAGATC
ATTATAAAAGTTCCAGGAGACATGGAAGGTAATTTTCATGTGCAAGTTGGTATGAATATGCCTCTGAAGAAATGTTAATG
TGTCTTGGAACTTTTCAAGAAAAGCAACAGTGTAAAGAAAAATGCACTTCTTTAAGTGTATTTATTATTAAATTCTCACA
AATCCATGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI15779

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121806436..121806944 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078564 (BX000432.7) Novel zinc finger protein Fragment [Source:UniProtKB/TrEMBL;Acc:B1AZK8]

 
Come back to gene ENSMUSG00000078564


For any suggestions or comments, please send an email to unitrap@crg.es