Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST40388
Clone ID OST40388
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST40388
Sequence
GTAACTATGAAAGGCTTGTATTTTCAACAGAATTCTACAAATGAAGAAGTAACATTTGTATTTCAAGAAAAGGAAAANGN
CCCTGNCNCAGAGGATNACTNTGTGAGAGNTCAAGTTAAAGCTTGTGCCTTGAGCCACATAAACACAAAGCTTCTAGCAN
AAATGAAGATGGAAAAGGATTTCTTCCCTGTTGGAAGAGAAGTTTCTGGAATTGTATTAGAGGTTGGCAGGAAGGTAACG
NTCTTTCAGCCAGACGACGAAGTGGTCGGAATTCTGCCTTTGGATTCCGAAGACCCCGGGCTCTGTGAGGGTATTC
Sequence Type mRNA
Unitrap ID UNI22700

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91707491..91717720 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058240 (Cryzl1) NM_133679 crystallin, zeta (quinone reductase)-like 1 Gene [Source:MGI (curated);Acc:Cryzl1-003]

 
Come back to gene ENSMUSG00000058240


For any suggestions or comments, please send an email to unitrap@crg.es