Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST40377
Clone ID OST40377
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST40377
Sequence
TTTGCACTTGGGTCGGTAGNGGCAGTTACCAAGGCATCCGGGGGCCTGCCACAGTTGGGTGACNAGTATGATTTTTACAG
AAGTTTCCCTGCCTTCCAAGCATTCTGTGAGACACAAGGAGACAGGTTACTGCAGTGCATGAGTCNGGTAATGCAGTACC
ATGGCTGTCNCAGCAACATCAAAGACTTCANTCCCTATGACTACAGCCAGTCAGACTTCAGGGCCTTTGCTGGGGACAGT
AAATCCAAGCCTTCCTCCCAGTTCGACCCCAATAAGCTGGCACCTTCCGGCAAGAAAGGTGTTGGAGCCAAAAAATTTAA
ACAGTCGGTGGGAAACAAAAGCATGTCATTTGCTGTTGGAAAGTCGGACAGAGGCTTCCGCCACAACTGGCCAAAGAGAT
AGTGCTNGAGGGACTCCTGGGGCTGCCGACAGCGCTGCTTTGTACACACCTATTTTAAAACCATTAAAATGNATTTCCTA
CCAGAAAAAAAAGCAA
Sequence Type mRNA
Unitrap ID UNI8892

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147933657..147956510 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017264 (Exosc10) NM_016699 exosome component 10 Gene [Source:MGI (curated);Acc:Exosc10-005]

 
Come back to gene ENSMUSG00000017264


For any suggestions or comments, please send an email to unitrap@crg.es