Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST40345
Clone ID OST40345
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST40345
Sequence
GAAAAGCCAAGAATGCGTGTTCCCTGTGCCTCTCCCTGCCCCCCACTAACCCCAGTCCTATATTAATGATGCAACACTTC
TCACTGCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23858

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45203157..45203244 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066705 (Fxyd6) NM_022004 FXYD domain-containing ion transport regulator 6 Gene [Source:MGI Symbol;Acc:MGI:1890226]

 
Come back to gene ENSMUSG00000066705


For any suggestions or comments, please send an email to unitrap@crg.es