Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST40319
Clone ID OST40319
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST40319
Sequence
GGCCCCCAGCATGGTGCTCAAGGTCTTCTTCCCCACGTGCTGTGCCTCGGCAGACAGTGGCCTGTTAGTGGGACGATGGG
TTCCAGGACAGAGCAGTGCTGTGATCCTGGCCGTGGTGCACTTTCCCTTCATCCCCATCCAAGAAAGAAAAAA
Sequence Type mRNA
Unitrap ID UNI28084

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26074265..26074407 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025728 (Pigq) NM_011822 phosphatidylinositol glycan anchor biosynthesis, class Q Gene [Source:MGI Symbol;Acc:MGI:1333114]

 
Come back to gene ENSMUSG00000025728


For any suggestions or comments, please send an email to unitrap@crg.es