Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST40230
Clone ID OST40230
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST40230
Sequence
CAGAATAAAGATGCTTAGAACTCTAGAAGCCAAGAGACTGGCAGCCATGGAATCCTCTGTAAATCTCCCAGCAAGGTCTC
CCAAGGGTGGTGGAGCCCAGCAGACTACTAGCACAAGCAGTCAACTGAAGTCTAAAGGTGGGCGATCAGATGAAGACGGA
CCACCTTCCACCCGCAGACCATTCTACAAGACTAGAGCAGACTTTCTCAAGAGACATCGTTAACTCAATACAAAGACCAA
GTGAGAGCAGCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28088

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98456715..98457301 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031304 (Il2rg) NM_013563 interleukin 2 receptor, gamma chain Gene [Source:MGI (curated);Acc:Il2rg-005]

 
Come back to gene ENSMUSG00000031304


For any suggestions or comments, please send an email to unitrap@crg.es