Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST40186
Clone ID OST40186
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST40186
Sequence
GGAGAATCTTGCTAGCGACATGTACCTTATATCCCAGATGGACAGTGATCAGTATGTGCCAATTACAACGGTAGCTAACC
TTGACCATATCAAGAAACTCAGTACTGATGTGGATTTGATTGTTGAAGTGCTAAGATCTTTACCTTTAGTCCAAGTGGAT
GAGAAGGGAGAGAAAGTAAGGCCAAATCAGAACCGGTGCATAGTAATACTGCGTGAGATATCGGAGTCTACCCCCGTGGA
AGAAGTAGAAGCACTATTTAAAGGAGATAATTTACCAAAATTTATAAACTGTGAATTTGCCTATAATGATAATTGGTTTA
TTACCTTTGAAACAGAAGCTGATGCACAGCAGGCTTACAAATACCTTCGAGAAGAAGTCAGAACTTTCCAAGGAAAGCCA
ATTAAGGCGCGGATAAAAGCAAAGGCAATAGCGATAAACACATTTTTGCCAAAGAATGGATTTAGACCTCTGGACATGAA
CCTTTATACCCAGCAGCGCTATGCTACATCGTTTTACTTACCTCCAGTGTCAGTCCCCAGCAGCAGTTCCCTCTGTCAGC
CTGATCACCCCCCAGACGTGGTCAACAACACATAGCTATCTTGGATCCACCCTTTGGTAACTCCTTTTTCCAAGTACTGG
GATTTATAAATGGGGTTACCATCTCCGAACCTTNAAACCTGNAACGGCTCCTCCCTTCCCAGACTTGA
Sequence Type mRNA
Unitrap ID UNI8706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9144628..9150481 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033499 (Larp5) NM_172585 La ribonucleoprotein domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:106330]

 
Come back to gene ENSMUSG00000033499


For any suggestions or comments, please send an email to unitrap@crg.es