Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST40179
Clone ID OST40179
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST40179
Sequence
GAAACCTTAAGAATGGAGTCTAAACCTTCCAGGATTCCAAGAAGAATTTCTGTTCAACCCTCTGGCTCTTTAAGCACTAG
GATGGTGTCTGGAAACAGAGGAACCAGTTTAAATGATTCATATCATTCTAGAGACTCCTCCTTTAGACTNGATCTCTGAA
GACTCTGGGCATCAGCATCAGCGTGTGCATCACCATGTCAGCCTGCCTGGTACAGTGAGTCTGAGATACCTCAGGGAGCG
CGGGCACGAGCACAGACCCAGCAGCGGGATCATGACTCAAAGAGACCCAAGCTTTCCTGTACAAACTGTGCATCTACCTC
AGCTGGGAGGAACGGTGGGAGTGGGTTAAATACAGNGNCAGGTAAGCTATGCACTTTCTGGTAAAGNCACTGGAGGAATA
TTCTGAACCAAAGCCTTTTCCCCCCCACCCCCACCCCCTAAGATTCTTAAATTTTTGAGTTAAATAGATNCTTTACAATA
GNGGATTTGGAAATTCGGAGNNCTAAAANTNTACTTTAAACTGGNGGGAAAAATGAAATCACTGGGGCTGGA
Sequence Type mRNA
Unitrap ID UNI17611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 60066975..60068130 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026977 (March7) NM_020575 membrane-associated ring finger (C3HC4) 7 Gene [Source:MGI (curated);Acc:March7-003]

 
Come back to gene ENSMUSG00000026977


For any suggestions or comments, please send an email to unitrap@crg.es