Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XK164
Clone ID XK164
Vector pGT0Lxf
Project baygenomics

Sequence tag XK164
Sequence
GGGGGGGGGGGGAAAAAGTCCTAGCAGCTGGAAGGAACCCGCGCTCTAGTGCTCACTTGGGTCTTCAGCCACTCACGCGG
CTCCCTTCTGGGTCACCCAGCCGCAGAGCCCTAGCCTAGAACCAGGCGTTCCAAGGGAGAGGAGAGTGCGGATCGCCGCC
GTGATAGAGTACATCGGCATCATGTGGATCCAGGTTCGAACTATGGATGGGAAGGAGACCCACACCGTGAACTCTCTGTC
CAGGTTGACCAAGGTGCAGGAGCTGAGGAAAAAGATTGAGGAAGTGTTTCACGTGGAACCCCAACTACAGAGACTCTTTT
ATAGGGGCAAA
Sequence Type mRNA
Unitrap ID UNI7686

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56442823..56444670 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]

 
Come back to gene ENSMUSG00000001228


For any suggestions or comments, please send an email to unitrap@crg.es