Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XK167
Clone ID XK167
Vector pGT0Lxf
Project baygenomics

Sequence tag XK167
Sequence
GGATTTGAAACATTTGAAATAAATAGTTTTGAACAGTTCTGCATAAATTATGCAAATGAAAAACTACAACAACAATTCAA
CATGCATGTCTTCAAATTGGAACAGGAGGAATATATGAAGGAACAGATTCCATGGACACTTATAGATTTCTATGATAATC
AGCCTTGTATCAATCTTATAGAATCTAAACTGGGAATTCTCGATTTGCTGGATGAGGAATGTAAGATGCCTAAAGGCACA
GATGACACATGGGCCCAAAAACTGTACAACACACATTTGAACAAATGTGCCCTCTTTGAGAAGCCCCGCATGTCAAACAA
AGCTTTCATCATCAAACATTTTGCTGACAAAGTGGAGTACCAGTGTGAAGGTTTTCTTGAAAAGAATAAAGATACTGTTT
TTGAAGAACAAATTAAAGTCCTTAAGTCAAGCA
Sequence Type mRNA
Unitrap ID UNI9065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 74995662..75004070 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034593 (Myo5a) NP_034994 myosin Va Gene [Source:MGI (curated);Acc:Myo5a-001]

 
Come back to gene ENSMUSG00000034593


For any suggestions or comments, please send an email to unitrap@crg.es