Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST40097
Clone ID OST40097
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST40097
Sequence
ACAGTCCAGGATGGCCGACAGTTTCTGAAGTATGTGGATCCCAGGCTGGGAGTCCCATTGCCAGAGAGGGACTACGGGGG
CAACTGCCTCATCTATGATGCTGACAACAAGACTGACCCTTTCCACAACATCTGGGACAAGCTGGATGGCTTTGTTCCTG
CACACTTCATTGGCTGGTATCTGAAGACGCTCATGATCCGTGACTGGTGGATGTGCATGATCATCAGTGTGATGTTCGAG
TTCCTGGAGTACAGCCTGGAGCACCAGCTGCCCAACTTCAGCGAGTGCTGGTGGGACCATTGGATCATGGACGTCCTCGT
CTGCAACGGGCTGGGCATCTACTGTGGCATGAAGACCCTCGAGTGGCTGTCCCTGAAGACATATAAGTGGCAGGGCCTCT
GGAACATTCCAACCTACAAGTACATCTTGGGAGTTATAGAAGGGAACCACAGAGCATTGGGCCCGCAAGGACAAGGCCTT
GCTACTTGGGAGGGTGGCAAGCAAAACATTAGAGTGGTAGAGAGTGACTGCTAGTCCTNCATCTGGCTCCTGCTTGCTTC
TCTCAAGAGCTGTGGCCTGATCTATCCACTNTCTACAGCCTAGGTGNCNTAGCTTGTCTGTCTCTAATGACTTNGNCCCA
ATTCCGGAGCATAATGNGACCCTATGCAAGTCTTGTACTATAGATTAGAAAGAAAATTGGCCTGAAANGGGGNATATGCT
TANAGCCCTTGGTTGTAACTGAGCCGA
Sequence Type mRNA
Unitrap ID UNI14633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148337549..148339184 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025495 (Ptdss2) NM_013782 phosphatidylserine synthase 2 Gene [Source:MGI Symbol;Acc:MGI:1351664]

 
Come back to gene ENSMUSG00000025495


For any suggestions or comments, please send an email to unitrap@crg.es