Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST40048
Clone ID OST40048
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST40048
Sequence
GTGAAGGCCTCCCACAGGTTTATTACTTTGGACCATGTGGGAAGTACAATGCCATGGTGCTGGAACTCCTTGGCCCTAGC
TTGGAAGACTTGTTTGACCTCTGTGACCGAACGTTTACTTTGAAGACGGTGTTAATGATAGCCATCCAGTTGCTTTCTCG
AATGGAGTATGTACACTCAAAGAATCTTATTTACCGAGATGTCAAACCAGAGAACTTCTTGATTGGCCGACAAGGCAATA
AGAAAGAGCATGTAATACACATTATAGATTTTGGACTGGCCAA
Sequence Type mRNA
Unitrap ID UNI8828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65847202..65849984 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032384 (Csnk1g1) NM_173185 casein kinase 1, gamma 1 Gene [Source:MGI (curated);Acc:Csnk1g1-001]

 
Come back to gene ENSMUSG00000032384


For any suggestions or comments, please send an email to unitrap@crg.es