Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST40030
Clone ID OST40030
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST40030
Sequence
GGGACAAGCGCTTTGAGTGTGCCCAATGTCAGAAGCGCTTCATGAGGAGTGACCACCTCACCAAGCATTACAAGACCCAC
CTAGGCACGAAGGGCTTGTAAGGCCAACTGAGGCAGGAGGCCCTGAAGATGGAACACCTCCCATCTGATTGGCCCTGGGT
CCATGATGGACAGGTGCCCACGACTGCCCTGGGCAGCCCTCACCCCACTCCTGTTCTGTGGCTGTGTCCCTGCAGAGAGG
GACTCTGTTCCTGTGTTCTCCTCCTTCCAAAGGCTCTGCCCCTCTCACCGTGAGCTCCTGGCCTGCCCAGGCCATGGACA
CTGGCCATGCCCAATGAGAACGTTCTAACCCAGGACGCGTGGGGACCCTTATTTCCAAAGGAAAAAA
Sequence Type mRNA
Unitrap ID UNI6798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96815500..96815884 382
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018678 (Sp2) NM_030220 Sp2 transcription factor Gene [Source:MGI (curated);Acc:Sp2-001]

 
Come back to gene ENSMUSG00000018678


For any suggestions or comments, please send an email to unitrap@crg.es