Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST40017
Clone ID OST40017
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST40017
Sequence
GAAAATTGGACCGATTTCCACCTATGATGCATCACCACTCGGCACCCTCAGATGGTCAGACACCAGGGGCTCGTTTCCAG
AGGTCTCACCTTGCAGAGGCCTTTGCAAAGGCCAAGGGAGCAGGTGGAGGTGCTGGAGGAGGGGGTAGTGGAAGAGGACT
GATGGGCCAGATCATTCCAATCTATGGCTTTGGGATCTTTTTGTACATACTGTACATTTTGTTTAAGGTAAGTGAAATTA
TCCTATATGNATAAGATGTATGTATATCTTATATATGTATATCACG
Sequence Type mRNA
Unitrap ID UNI28102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116201240..116201523 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048330 (Ric3) NM_001038624 resistance to inhibitors of cholinesterase 3 homolog (C. elegans) Gene [Source:MGI (curated);Acc:Ric3-001]

 
Come back to gene ENSMUSG00000048330


For any suggestions or comments, please send an email to unitrap@crg.es