Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST39858
Clone ID OST39858
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST39858
Sequence
AAATGCCCGGTGAAGCCACAGAAACCGTCCCTGCTACAGAGCAGGAGTTGCCACAGCCTCAGGCTGAGACAGGATCGGGA
ACAGAGTCTGACAGTGATGAGTCAGTACCAGAGCTCGAGGAACAAGACTCCACACAGACGGCCACGCAGCAAGCCCAGCT
GGCAGCCGCAGCAGAGATCGATGAAGAACCTGTTAGTAAAGCCAAGCAGAGTCGAAGTGAGAAGAAGGCAAGGAAGGCTA
TGTCCAAACTGGGTCTTCGACAGGTTACAGGGGTTACGAGAGTCACTATCCGAAAATCTAAAAATATCCTCTTTGTCATC
ACAAAACCCGATGTCTACAAGAGCCCAGCTTCAGACACCTACATAGTGTTTGGGGAAGCCAAGATTGAAGATTTGTCTCA
GCAAGCACAGTTAGCAGCTGCTGAGAAATTCAAAGTTCAAGGTGAAGCTGTTTCAAACATTCAGGAAAACACTTAGACTT
CAACCCGTNCAAGANGAGAGTGAAGAAGAAGAGGTTGATGAGACCGGTGTGGAAGTTAAGGACATAGAACTGGNCATTGT
CGCAAGCAAACGTATCAAGAGCCAAAGNTTGTTCGAGCCCTTGAAAACCAACNGTAATGATATTGNAAATGCTATTATTG
GAATTTACCAATGNAACTTNTTTTGACAGCGGAAGAACAACTTNCCCCNTTTTCCCCCCCTTTTTTGGGGGGGTTTTGGA
AAAAAGGNNGGGGAACCTTCCCAGNCTTTGGGGTTTTAAAAAAANTTTTGGGAACCTGGGGGNNNCNTAATTTCNCCTTT
AAATTAAAAAGGTTTGGNGGGGGCTTTTNTTTTGGGTTTGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI5829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127473545..127485422 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es