Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST39826
Clone ID OST39826
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST39826
Sequence
TCAAAAAGTCATCCATCCGTACAGNAGAAAAGCAGCTCAGATTACAAGAGAGTCTCACAAACAAGACTAGACGGAAAGAT
T
Sequence Type mRNA
Unitrap ID UNI12551

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 69007957..69008032 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025591 (1810029B16Rik) NM_025465 RIKEN cDNA 1810029B16 gene Gene [Source:MGI Symbol;Acc:MGI:1913532]

 
Come back to gene ENSMUSG00000025591


For any suggestions or comments, please send an email to unitrap@crg.es