Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST39771
Clone ID OST39771
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST39771
Sequence
GGTGTTGTGACCTATGATGATGTGCNTGTGAACTTCACTCAGGAAGAGTGGGCTTTGCTGGATCCTTCTCAAAAGAATCT
CTACAGAGATGTGATGCTGGAGACCTACAGGAATCTTGCTGCTATAGGCTACAGTTGGGAAGACCATAATCCTGAAGAAC
ATTTTCAAAGTTCTAGAAGACATGGAAGGCTTGAAAAAAGTCATANTGGAGAAAAACCCNNTGNATTTACNCNATGGGGG
AAAGGCATTGGNTANCAAANCCCTCCTNAAGGGCNTTAACCAATTCCTTCCGGGAGAGAAACCCTNTGAATGGGAGCCAT
GGGGGAAA
Sequence Type mRNA
Unitrap ID UNI809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150062428..150064117 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060336 (RP23-91K11.5) Novel zinc fingerprotein [Source:UniProtKB/TrEMBL;Acc:A2ANU7]

 
Come back to gene ENSMUSG00000060336


For any suggestions or comments, please send an email to unitrap@crg.es