Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST39439
Clone ID OST39439
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST39439
Sequence
AGAGGTGATGGCTATGTGGATACATGANAGCAAGTTCCGGAAACTGGTGACCGNCATCAAAGCTGCCTTGGCTCAGTGCC
AGTGAGCCCTAGAGGCAGGGTCCTGAAAGCTCCTGGCCGGCCTTCCTTGGCAGCCGCTTCATGACAGGAAGGACTGAAAT
GTCTTANACCTGTGGTCTTTCCTCGATGTTCCTGCGGCCACCAAGTCANGCCANAGATGGATTCTGGCTGTGGGTGCCTC
CCCAGAATCTACCCGTGCACGCAGCCTGCCNTGACCCCCTGCCCTCTTCCCCACCTCTCTCTCTGAATTCCCCCATTGTT
TCCCACCCACCCTCCTGCTTTGCTTTCCCTTTCCACCTCAAGACTTCAAGAAGACAGGCAGCCATGTTTCCAGGTGTTCC
CGG
Sequence Type mRNA
Unitrap ID UNI28121

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16502586..16505295 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041571 (Sepw1) NM_009156 selenoprotein W, muscle 1 Gene [Source:MGI (curated);Acc:Sepw1-001]

 
Come back to gene ENSMUSG00000041571


For any suggestions or comments, please send an email to unitrap@crg.es