Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XK101
Clone ID XK101
Vector pGT0Lxf
Project baygenomics

Sequence tag XK101
Sequence
GGGGGGGGGGGGGGGGGGTTTACATGCGCACCATGATGCAGACGCTTGCCCAGAACCCTGACTTTGCTGCTCAGATGATG
GTGAATGTGCCGCTGTTCGCAGGGAATCCACAGCTTCAGGAGCAGCTCCGCCTGCAGCTCCCCGTGTTTCTGCAGCAGAT
GCAAAACCCAGAGTCTCTCTCCATCCTCACCAATCCCCGGGCCATGCAG
Sequence Type mRNA
Unitrap ID UNI9005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88368377..88369015 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008604 (Ubqln4) NM_033526 ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]

 
Come back to gene ENSMUSG00000008604


For any suggestions or comments, please send an email to unitrap@crg.es