Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XK123
Clone ID XK123
Vector pGT0Lxf
Project baygenomics

Sequence tag XK123
Sequence
GAAGGCTACTTGGAGGCCTTGGCTAACAAGGAGAAGAGCAGGAAGCGCCCGGCCAAGGCCTTGGAGCAGGGACCCTCATC
TTCCAAGACAGGCAAAAGCAAGCAGAAGTCCACAGGGCCAACCCTCTCCAGCCCCCGTGCCTCTAAGAAGAGCAAGCTGG
AGCCGTACACACTCTC
Sequence Type mRNA
Unitrap ID UNI9084

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56459591..56459880 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]

 
Come back to gene ENSMUSG00000001228


For any suggestions or comments, please send an email to unitrap@crg.es