Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST39222
Clone ID OST39222
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST39222
Sequence
ATTTGGCTTTCTATATGTGGCCTCAGCTCCAGCTCCACCTATGTGGACCGCGGATGAGATCGCTCAGCTGTGCTATGCAC
ACTATAACCGTCAGACTGCCCAAGCAGGGGAAGCCTGAGCCAAATCGTGAGTGGACCTTGCTGGCAGCTGTGGTGAAGNT
TCAGGCTTCAGCTAACCAAGCTTGTGACATCCCTGAGAAGGAAGTGCAAGTGACAAAGGAAGTTGTCTCAATGGGAACAG
GAACAAAATGCATAGGCCAGTCCAAGATGCGAGAGAGCGGGGACATCCTCAATGACAGCCATGCTGAGATCATAGCCAGA
AGGAGTTTCCAGAGATACCTTCTCCATCAGCTCATTTGGCAGCCCGTCCTGAAAGAGGATAGCATCTTTGTTCCAGGGAC
CCAAAGAA
Sequence Type mRNA
Unitrap ID UNI24679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114511080..114514312 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031949 (Adat1) NM_013925 adenosine deaminase, tRNA-specific 1 Gene [Source:MGI (curated);Acc:Adat1-002]

 
Come back to gene ENSMUSG00000031949


For any suggestions or comments, please send an email to unitrap@crg.es