Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST39011
Clone ID OST39011
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST39011
Sequence
CCCAAAATGAATATATTGAATTGCACCGCAAACGATACGGATATCGTTTGGACTACCATGAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97905591..97905660 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060739 (5730427N09Rik) NM_021552 RIKEN cDNA 5730427N09 gene Gene [Source:MGI Symbol;Acc:MGI:1913883]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 22515631..22515700 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052387 (Trpm3) NM_001035244 transient receptor potential cation channel, subfamily M, member 3 Gene [Source:MGI Symbol;Acc:MGI:2443101]

 
Come back to gene ENSMUSG00000052387


For any suggestions or comments, please send an email to unitrap@crg.es